resource source identifier cfx maestro software bio rad (Bio-Rad)

Bio-Rad is a verified supplier

Bio-Rad manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio-Rad resource source identifier cfx maestro software bio rad
Resource Source Identifier Cfx Maestro Software Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 4014 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+software/CFX+Maestro+Software/pm41997140-302-2-8
Average 98 stars, based on 4014 article reviews

resource source identifier cfx maestro software bio rad - by Bioz Stars, 2026-09

98/100 stars

Images

Software:

Article Title: Stn1-Ten1 and Taz1 independently promote replication of subtelomeric fragile sequences in fission yeast.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Rad51 abcam Cat# ab63799, RRID:AB_1142602 Anti-GFP Invitrogen Cat# A-11122, RRID:AB_221569 Anti-Myc (c-Myc antibody; 9E10) Santa cruz Cat# sc-40; RRID: AB_2892598 Chemicals, peptides, and recombinant proteins Proteinase K Euromedex EU0090 RNase A DNase-free Roche 11119915001 Dynabeads protein G Invitrogen 10003D CutSmart buffer New England Biolabs B7204S ApaI, recombinant New England Biolabs R0114S Nourseothricin Jena Bioscience AB102L Geneticin Gibco 10131–026 Hygromycin Invitrogen 10687010 Hybond-XL membrane Dutsher RPN2035 Deoxycytidine 50-triphosphate (a-32P) Perkin Elmer BLU013Z250UC Formaldehyde Sigma F-8775 Glycerol Euromedex EU3550 MOPS Euromedex EU0034 Potassium acetate Sigma-Aldrich P1190 EDTA Euromedex EU0007 SDS Euromedex EU0360-A Buffer G2 Qiagen 1014636 Buffer QC Qiagen 19055 Buffer QBT Qiagen 19054 Buffer QF Qiagen 19056 N-lauroyl sarcosine Sigma-Aldrich 61747 RnaseH2 New England Biolabs M0288 USER New England Biolabs M550 T4 polymerase New England Biolabs M0203 Ampure XP beads Beckman Coulter A63880 NEB Next Ultra II DNA library Prep kit New England Biolabs E7645 Zymolyase Amsbio 120493–1 Critical commercial assays TB Green premix Ex Taq II (Tli RNase H Plus) TAKARA RR820W InnuPrep PCR pure Kit AnalytikJena 845-KS-5010250 2% agarose gel casette Sage Science BEF2010 Genomic tips G-100 Quiagen 10223 High Sensitivity DNA Chips Agilent Technology 5067–4626 Deposited data NCBI GEO repository (GSE207082) NCBI N/A Experimental models: Organisms/strains See Table S1 for a list of yeast strains used in this study N/A N/A Oligonucleotides See Table S2 for a list of primers used in this study N/A N/A (Continued on next page) 18 Cell Reports 42, 112537, June 27, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms Quantity One 1-D analysis software Biorad N/A Bowtie 2 Johns Hopkins University N/A GitHub repository (https://doi.org/10.5281/zenodo.7890318) GitHub N/A Samtools MIT N/A R studio GNU N/A Prism 6 GraphPad N/A Papers 3 Digital Science Research & Solutions Inc. N/A .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Stéphane Coulon (stephane.coulon@inserm.fr).

Article Title: Viral hijacking of hnRNPH1 unveils a G-quadruplex-driven mechanism of stress control.
Article Snippet: Article Viral hijacking of hnRNPH1 unveils a G-quadruplex- driven mechanism of stress control

Article Title: Antagonistic roles of canonical and Alternative-RPA in disease-associated tandem CAG repeat instability.
Article Snippet: Article Antagonistic roles of canonical and Alternative-RPA in disease-associated tandem CAG repeat instability

Article Title: Centromere/kinetochore is assembled through CENP-C oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pEGFP-C3- CENP-CCBD-3xDmrB ([166-324]-[677-724]-3xDmrB) This paper N/A pT2/HB Perry Hackett lab Addgene plasmid # 26557 pT2/HB-hCENP-CDOI (D848-854) This paper N/A pCMV (CAT) T7-SB100 Mates et al.80 Addgene plasmid # 34879 pBS-CENP-N(Knock in homology arm)mScarlet-CENP-N-BsR This paper N/A pBS-CENP-N(Knock in homology arms)mScarlet-CENP-N-Ecogpt This paper N/A pX335-U6-Chimeric_BB-CBhhSpCas9n(D10A) Cong et al.81 Addgene Plasmid #42335 pX335-CENP-N This paper N/A pBS-ACTB(Knock in homology arms)mScarlet-CENP-A-IRES-Ecogpt This paper N/A pX335-ACTB Hara et al.35 N/A pBS-CENP-C KO-PuroR This paper N/A pBS-CENP-C KO-BsR This paper N/A pX330-U6-Chimeric_BB-CBh-hSpCas9 Cong et al.81 Addgene Plasmid #42230 pX330-CENP-C KO #1 This paper N/A pX330-CENP-C KO #2 This paper N/A pGEX-6P-1 Cytiva Cat# 27-4597-01 pGEX-6P-1-CENP-CC-term (677-864) This paper N/A pGEX-6P-1-Mif2pC-term (307-549) This paper N/A pGEX-6P-1-CENP-CC-term PP (677-864 F756P/F757P) This paper N/A pGEX-6P-1-hCENP-CC-term (760-943) This paper N/A pGEX-6P-1-hCENP-CC-termDOI (760-943 D846-851) This paper N/A pGEX-6P-1-CENP-CCBD (166-324) This paper N/A pGEX-6P-1-Mini-CENP-C ([166-324]-[677-864]) This paper N/A pRSFDuet-MBP-CENP-NC-term-MBP-CENP-L (CENP-N aa 252-344, CENP-L aa 13-344) Nagpal et al.37 N/A pMal-T-Avi-His/BirA Tonia Rex lab Addgene plasmid # 102962 pGEM-T Easy Promega Cat# A1360 pGEM-T Easy NeoCen#1320 A This paper N/A pGEM-T Easy NeoCen#1320 B This paper N/A pGEM-T Easy NeoCen#1320 C This paper N/A pGEM-T Easy NeoCen#1320 D This paper N/A pGEM-T Easy ChrZ centromere A This paper N/A pGEM-T Easy ChrZ centromere B This paper N/A pGEM-T Easy ChrZ centromere C This paper N/A pGEM-T Easy ChrZ centromere D This paper N/A pGEM-T Easy ChrZ centromere E This paper N/A pGEM-T Easy ChrZ centromere F This paper N/A pGEM-T Easy ChrZ centromere G This paper N/A pGEM-T Easy ChrZ centromere H This paper N/A pGEM-T Easy ChrZ centromere I This paper N/A (Continued on next page) e5 Molecular Cell 83, 2188–2205.e1–e13, July 6, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms Image Lab 6.1.0 BioRad RRID:SCR_014210 Photoshop 2023 Adobe RRID:SCR_014199 Illustrator 2023 Adobe RRID:SCR_010279 NIS-elements AR 4.8 Nikon RRID:SCR_014329 Fiji 82 RRID:SCR_002285 Imaris 9.2.1 Bitplane RRID:SCR_007370 Prism7 GraphPad RRID:SCR_002798 Microsoft Excel for Mac Microsoft RRID:SCR_016137 guavaSoft 2.7 Merck https://www.emdmillipore.com/US/ en/20130828_204624?bd=1 InCyte 3.1 Merck https://www.emdmillipore.com/US/ en/20130828_204624 PROMALS3 Schindelin et al.83 RRID:SCR_018161 XDS Kabsch84 RRID:SCR_015652 Molrep (CCP4 suite) Vagin and Teplyakov,85 Winn et al.86 https://www.ccp4.ac.uk/html/molrep.html Coot Emsley et al.87 RRID:SCR_014222 REFMAC Murshudov et al.88 RRID:SCR_014225 DSSP Touw et al.89 https://swift.cmbi.umcn.nl/gv/dssp/ PyMOL Schrödinger, LLC RRID:SCR_000305 SoftWoRx software (v7.0.0) Cytiva RRID:SCR_019157 numpy 1.21.5 Harris et al.90 https://numpy.org/ scipy 1.7.3 Virtanen et al.91 https://www.scipy.org/ matplotlib 3.5.1 Hunter92 https://matplotlib.org/ scikit-learn 1.0.2 Pedregosa et al.93 https://scikit-learn.org/ QuantStudio Design and Analysis Software v1.5.1 Thermo Fisher Scientific RRID:SCR_020238 IUPred3 Erdos et al.46 RRID:SCR_014632 ..

Article Title: Stabilization of the hexasome intermediate during histone exchange by yeast SWR1 complex.
Article Snippet: GTGTCTTACC (complementary oligo to Biotin labelled DNA IDT N/A Recombinant DNA pFUBB:SWR1(SC1) This study N/A pFUBB:SWR1(SC2) This study N/A pFUBB:SWR1(SC1Dswc5) This study N/A pET22b:Chz1 This study N/A pET22b:Chz1(S98C) This study N/A pCDF(NdeI):Htz1/H2B(S115C) This study N/A pETDUET:H3(Q120M,K121P,K125Q)/H4 This study N/A pCDF(NdeI):H2A(N39C)/H2B This study N/A (Continued on next page) e2 Molecular Cell 84, 1–14.e1–e9, October 17, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms cryoSPARC v3.31 Punjani et al.45 https://cryosparc.com RELION 4.0 Scheres et al.46 https://www3.mrc-lmb.cam.ac.uk/ relion/index.php?title=Main_Page UCSF Chimera Petterson et al.47 https://www.cgl.ucsf.edu/chimera COOT Emsley et al.48 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/ AlphaFold v2.1.0 Jumper et al.24 https://colab.research.google.com/ github/deepmind/alphafold/blob/main/ notebooks/AlphaFold.ipynb Image Lab 6.1 BIO RAD https://www.bio-rad.com/en-uk/ product/image-lab-software?ID= KRE6P5E8Z Model Angelo Jamali et al.49 https://github.com/3dem/model-angelo RoseTTAFold Baek et al.50 https://robetta.bakerlab.org/ vbFRET Bronson et al.51 https://vbfret.sourceforge.net/ Igor Pro 8 WaveMetrics https://www.wavemetrics.net/previous8.html Excel 16.54 Microsoft https://scicrunch.org/resolver/SCR_016137 Phenix Liebschner et al.52 https://phenix-online.org/ ChimeraX Goddard et al.53 https://www.rbvi.ucsf.edu/chimerax Oligonucleotides .. (cloning S115C into H2B forward) IDT N/A

Article Title: The PP2A phosphatase counteracts the function of the 9-1-1 axis in checkpoint activation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Yeast nitrogen base with amino acids Merck Cat#Y1250-250G Hydrochloric acid Merck Cat#30721-1L-M Ethanol absolute Merck Cat#02860-2.5L Ammonium persulfate Merck Cat#A3678-25G IGEPAL CA-630 Merck Cat#I8896-100ML N,N,N0,N0-Tetramethylethylenediamine Merck Cat#T9281-50ML Dextran sulfate sodium salt from Leuconostoc spp Merck Cat#D8906-100G Lithium chloride Merck Cat#L9650-100G Sodium deoxycholate Merck Cat#30970-100G Acrylamide 4X solution Serva Cat#10677.1 N,N0-Methylene-bisacrylamide 2X Serva Cat#29197.01 2-Propanol Merck Cat#I9516-500ML Glycine for electrophoresis, R99% Merck Cat#G8898-1KG Formaldehyde solution for molecular biology, 36.5–38% in H2O Merck Cat#F8775-500ML Sodium hydroxide Merck Cat#1064621000 Sodium dodecyl sulfate Merck Cat#L3771-500G Trizma base Merck Cat#33742-2KG Ponceau s sodium practical grade Merck Cat#P3504-100G D-Sorbitol Merck Cat#S7547-1KG Complete Mini Roche Cat#11836153001 Ethylenediaminetetraacetic acid R98.0% Merck Cat#03620-1KG HEPES Merck Cat#H4034-1KG DL-Dithiothreitol Merck Cat#43819-25G Calcium carbonate Merck Cat#239216 Potassium chloride Merck Cat#P3911 Sodium phosphate dibasic Merck Cat#S9763 Potassium phosphate monobasic Merck Cat#P0662 Bio-Rad Protein Assay Dye Reagent Concentrate Bio-Rad Cat#5000006 Sodium orthovanadate Merck Cat#S6508-10G b-Glycerophosphate disodium salt hydrate Merck Cat#G9422 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Okadaic Acid Merck Cat#495604 Critical commercial assays Riboprobe System-T7 Promega Cat#P1440 QIAGEN QIAquick PCR Purification Kit QIAGEN Cat#28106 QIAquick Gel Extraction Kit QIAGEN Cat#28704 QIAprep Spin Miniprep Kit QIAGEN Cat#27104 Experimental Models: Organisms/Strains S. cerevisiae, see Table S1 This paper N/A Oligonucleotides ARO+: TGAGTCGTTACAAGGTGATGCC This paper N/A ARO-: ACCTACAGGAGGACCCGAAA This paper N/A DSB 0.6+: CACCCAAGAAGGCGAATAAG This paper N/A DSB 0.6-: CATGCGGTTCACATGACTTT This paper N/A DSB 1.8+: ACGTCGTTGTTAATGGTGGTG This paper N/A DSB 1.8-: CGCGAGTCTTATGCCAAAAA This paper N/A (Continued on next page) 14 Cell Reports 42, 113360, November 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms Bio-Rad CFX Maestro 1.1 Version: 4.1.2433.1219 Bio-Rad N/A Scion Image Beta 4.0.2 Scion Corporation N/A Other Primo FrameStar 96well PCR Plate, semi-skirted, clear wells Euroclone Cat#ECPCR0770C HYBOND-NX Nylon membrane GE Healthcare Cat#GEHRPN203T Nitrocellulose blotting membrane, AmershamTM ProtranTM 0.45 mm NC GE Healthcare Cat#GEH10600002 Hyperfilm MP GE Healthcare Cat#GEH28906844 ..

Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

Article Title: PAMless SpRY exhibits a preference for the seed region for efficient targeting.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli Top10 Thermo Fisher Scientific C404010 E. coli BL21 (DE3) New England Biolabs C2527H Chemicals, peptides, and recombinant proteins BsaI-HF v2 New England Biolabs R3733L DpnI New England Biolabs R0176L Hi-T4TM DNA Ligase New England Biolabs M2622L Tris-HCl Solarbio 77-86-1 NaCl MACKLIN 7647-14-5 imidazole Solarbio 288-32-4 glycerol Tianjing Kaitong 56-81-5 ethylenediaminetetraacetic acid (EDTA) Solarbio 6381-92-6 kanamycin sulfate Coolaber 25389-94-0 apramycin sulfate Coolaber 65710-07-8 D- + -Glucose Coolaber 50-99-7 L- + -Arabinose MACKLIN 87-72-9 4-(2-hydroxyerhyl)piperazine-1erhanesulfonic acid (HEPES) Coolaber 7365-45-9 dithiothreitol (DTT) Coolaber 3483-12-3 LB Hopebio HB0128 23YT Hopebio HBDC003 TB Hopebio HBDC004 Aidlab PCR product Purification kit Aidlab DR0202 Aidlab Miniprep DNA Purification kit Aidlab DR0302 Isopropyl b-D-Thiogalactoside (IPTG) MACKLIN 367-93-1 KCl MACKLIN 7447-40-7 MgCl2 MACKLIN 7786-30-3 Phenylmethylsulfonyl fluoride (PMSF) MACKLIN 329-98-6 Urea MACKLIN 57-13-6 Eagle’s minimum essential medium GibcoTM 11095080 10% fetal bovine serum GibcoTM 10082147 Pen-Strep-Glutamine (1003) GibcoTM 10378016 MEM nonessential amino acids (1003) GibcoTM 11140050 Deposited data NGS raw study This work NCBI SRA accession number: PRJNA1104137 Experimental models: Cell lines 293T human embryonic kidney cell line ATCC CRL-11268 Oligonucleotides For plasmids used in this work, please refer to Tables S2 and S3 This work N/A Recombinant DNA For plasmids used in this work, please refer to Table S1 This work N/A (Continued on next page) 10 Cell Reports 43, 114225, May 28, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms Anaconda Navigator https://docs.anaconda.com/free/ navigator/index.html N/A ImageJ http://imagej.net N/A For custom Python codes, see Method S1 This paper N/A Other Pharos FX molecular imager system Bio-Rad Laboratories N/A Ni SepharoseTM 6 Fast Flow Cytiva 17-5318-06 HiTrapTM SP HP Cytiva 17-1152-01 .. FEMS Microbiol.

Review

resource source identifier cfx maestro software bio rad (Bio-Rad)

Structured Review

Images

Related Articles

Software:

Polymerase Chain Reaction:

Membrane:

Magnetic Beads:

Imaging:

Thin Layer Chromatography:

Pore Size:

Microscopy:

Inverted Microscopy:

Reverse Transcription Polymerase Chain Reaction:

Similar Products

Image Search Results